Please note that some of the reporter dyes in the dual-label probes are priced
differently from the same dyes when used in single-label probes. In a
single-label probe, the reporter dye is usually coupled to the 5'-end of the
oligonucleotide/probe (similarly to the dual-label probes) but the 3'-end lacks
a quencher. The synthesis of the single-label probes can be done in two steps:
(a) the DNA part of the oligo is always synthesized on the machine (the DNA
synthesizer), but then (b) the reporter dye (a.k.a. the fluorophore, or simply
the dye) can be added post-synthetically, after the cleavage of the oligo from
the solid support. This type of modification allows the use of less
expensive reagents. This is the reason why our prices for most fluorescent
dyes are quite low, if you look at the Web page with the prices for the
single-label dye modifications here.
By contrast, the synthesis of the dual-label probes does not allow the 5'-end
reporter dye to be added post-synthetically, for the dual label (reporter-quencher)
probes, the 5'-end dye MUST be added on the machine (the DNA synthesizer), which
limits our choice of reagents; we are obliged to use more expensive reagents,
and as a result, some of the reporter dyes, within the context of a dual-label
probe, may cost significantly more than the same reporter dyes in the context of
a single-label probe.
Fluorescein---BHQ1, 200
nmol scale
Fluorescein---BHQ1,
1000 nmol scale
Fluorescein---TAMRA, 100
nmol scale
Fluorescein---TAMRA, 200
nmol scale
Fluorescein---TAMRA, 1000
nmol scale
6-FAM---BHQ1, 100 nmol scale
6-FAM---MGB, 100 nmol scale
6-FAM---BHQ1, 200 nmol scale
6-FAM---MGB, 200 nmol scale
6-FAM---BHQ1, 1000 nmol scale
6-FAM---MGB, 1000 nmol scale
HEX---BHQ1, 100 nmol scale
HEX---BHQ1, 200 nmol scale
HEX---BHQ1, 1000 nmol scale
TET---BHQ1, 100 nmol scale
TET---BHQ1, 200 nmol scale
TET---BHQ1, 1000 nmol scale
6-FAM---TAMRA, 100 nmol
scale
6-FAM---TAMRA, 200 nmol
scale
6-FAM---TAMRA, 1000 nmol
scale
VIC-repl.---BHQ1, 100 nmol scale
VIC-repl.---BHQ1, 200 nmol
scale
VIC-repl.---BHQ1, 1000 nmol
scale
NED-repl.---BHQ2, 100 nmol scale
NED-repl.---BHQ2, 200 nmol scale
NED-repl.---BHQ2, 1000 nmol scale
PET-repl.---BHQ2, 100 nmol scale
PET-repl.---BHQ2, 200 nmol scale
PET-repl.---BHQ2, 1000 nmol scale
LIZ-repl.---BHQ2, 100 nmol scale
LIZ-repl.---BHQ2, 200 nmol scale
LIZ-repl.---BHQ2, 1000 nmol scale
ROX-repl.---BHQ2, 100 nmol scale
ROX-repl.---BHQ2, 200 nmol scale
ROX-repl.---BHQ2, 1000 nmol scale
Cy3---BHQ2, 100 nmol scale
Cy3---BHQ2, 200 nmol scale
Cy3---BHQ2, 1000 nmol scale
Cy3.5---BHQ2, 100 nmol scale
Cy3.5---BHQ2, 200 nmol scale
Cy3.5---BHQ2, 1000 nmol scale
Cy5---BHQ2, 100 nmol scale
Cy5---BHQ2, 200 nmol scale
Cy5---BHQ2, 1000 nmol scale
Cy5.5---BHQ3, 100 nmol scale
Cy5.5---BHQ3, 200 nmol scale
Cy5.5---BHQ3, 1000 nmol scale
TAMRA---BHQ2, 100 nmol scale
TAMRA---BHQ2, 200 nmol scale
TAMRA---BHQ2, 1000 nmol scale
Texas Red-repl.---BHQ2, 100 nmol scale
Texas Red-repl.---BHQ2, 200 nmol scale
Texas Red-repl.---BHQ2, 1000 nmol scale
D4-repl.---BHQ2, 100 nmol scale
D4-repl.---BHQ2, 200 nmol scale
D4-repl.---BHQ2, 1000 nmol scale
D3-repl.---BHQ3, 100 nmol scale
D3-repl.---BHQ3, 200 nmol scale
D3-repl.---BHQ3, 1000 nmol scale
IRD700-repl.---BHQ3, 100 nmol scale
IRD700-repl.---BHQ3, 200 nmol scale
IRD700-repl.---BHQ3, 1000 nmol scale
Quasar 705---BHQ3, 100 nmol scale
Quasar 705---BHQ3, 200 nmol scale
Quasar 705---BHQ3, 1000 nmol scale
Redmond Red---BHQ2, 100 nmol scale
Redmond Red---BHQ2, 200 nmol scale
Redmond Red---BHQ2, 1000 nmol scale
Yakima Yellow---BHQ1, 100 nmol scale
Yakima Yellow---BHQ1, 200 nmol scale
Yakima Yellow---BHQ1, 1000 nmol scale
Synthesis scale |
5'-end reporter dye |
DNA part of the dual-label probe (DNA sequence); the 20-mer sequence
below is only given as an example, the customer would have to replace it
with his/her own sequence, and calculate the price accordingly |
3'-end quencher |
Price calculation |
Price for the probe (desalted), in USD or CAD* |
100 nmol |
fluorescein |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
24.00 |
20 x 0.29 = 5.80 |
50.00 |
24 + 5.80 + 50 |
79.80 $ |
200 nmol |
fluorescein |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
24.00 |
20 x 0.39 = 7.80 |
50.00 |
24 + 7.80 + 50 |
81.80 $ |
1000 nmol |
fluorescein |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
50.00 |
20 x 0.79 = 15.80 |
100.00 |
50 + 15.80 + 100 |
165.80 $ |
100 nmol |
fluorescein |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
TAMRA |
|
|
|
24.00 |
20 x 0.29 = 5.80 |
49.00 |
24 + 5.80 + 49 |
78.80 $ |
200 nmol |
fluorescein |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
TAMRA |
|
|
|
24.00 |
20 x 0.39 = 7.80 |
49.00 |
24 + 7.80 + 49 |
80.80 $ |
1000 nmol |
fluorescein |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
TAMRA |
|
|
|
50.00 |
20 x 0.79 = 15.80 |
149.00 |
50 + 15.80 + 149 |
214.80 $ |
100 nmol |
6-FAM or HEX or TET |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
29.00 |
20 x 0.29 = 5.80 |
50.00 |
29 + 5.80 + 50 |
84.80 $ |
100 nmol |
6-FAM or HEX or TET |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
MGB |
|
|
|
29.00 |
20 x 0.29 = 5.80 |
95.00 |
29 + 5.80 + 95 |
129.80 $ |
200 nmol |
6-FAM or HEX or TET |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
29.00 |
20 x 0.39 = 7.80 |
50.00 |
29 + 7.80 + 50 |
86.80 $ |
200 nmol |
6-FAM or HEX or TET |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
MGB |
|
|
|
29.00 |
20 x 0.39 = 7.80 |
95.00 |
29 + 5.80 + 95 |
131.80 $ |
1000 nmol |
6-FAM or HEX or TET |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
75.00 |
20 x 0.79 = 15.80 |
100.00 |
75 + 15.80 + 100 |
190.80 $ |
1000 nmol |
6-FAM or HEX or TET |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
MGB |
|
|
|
29.00 |
20 x 0.29 = 5.80 |
285.00 |
75 + 15.80 + 285 |
375.80 $ |
100 nmol |
6-FAM |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
TAMRA |
|
|
|
29.00 |
20 x 0.29 = 5.80 |
49.00 |
29 + 5.80 + 49 |
83.80 $ |
200 nmol |
6-FAM |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
TAMRA |
|
|
|
29.00 |
20 x 0.39 = 7.80 |
49.00 |
29 + 7.80 + 49 |
85.80 $ |
1000 nmol |
6-FAM |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
TAMRA |
|
|
|
75.00 |
20 x 0.79 = 15.80 |
149.00 |
75 + 15.80 + 149 |
239.80 $ |
100 nmol |
VIC-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
29.00 |
20 x 0.29 = 5.80 |
50.00 |
29 + 5.80 + 50 |
84.80 $ |
200 nmol |
VIC-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
29.00 |
20 x 0.39 = 7.80 |
50.00 |
29 + 7.80 + 50 |
86.80 $ |
1000 nmol |
VIC-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
75.00 |
20 x 0.79 = 15.80 |
100.00 |
75 + 15.80 + 100 |
190.80 $ |
100 nmol |
JOE-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
29.00 |
20 x 0.29 = 5.80 |
50.00 |
29 + 5.80 + 50 |
84.80 $ |
200 nmol |
JOE-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
29.00 |
20 x 0.39 = 7.80 |
50.00 |
29 + 7.80 + 50 |
86.80 $ |
1000 nmol |
JOE-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
75.00 |
20 x 0.79 = 15.80 |
100.00 |
75 + 15.80 + 100 |
190.80 $ |
100 nmol |
NED-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.29 = 5.80 |
50.00 |
80 + 5.80 + 50 |
135.80 $ |
200 nmol |
NED-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.39 = 7.80 |
50.00 |
80 + 7.80 + 50 |
137.80 $ |
1000 nmol |
NED-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
240.00 |
20 x 0.79 = 15.80 |
100.00 |
240 + 15.80 + 100 |
355.80 $ |
100 nmol |
PET-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.29 = 5.80 |
50.00 |
80 + 5.80 + 50 |
135.80 $ |
200 nmol |
PET-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.39 = 7.80 |
50.00 |
80 + 7.80 + 50 |
137.80 $ |
1000 nmol |
PET-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
240.00 |
20 x 0.79 = 15.80 |
100.00 |
240 + 15.80 + 100 |
355.80 $ |
100 nmol |
LIZ-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.29 = 5.80 |
50.00 |
80 + 5.80 + 50 |
135.80 $ |
200 nmol |
LIZ-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.39 = 7.80 |
50.00 |
80 + 7.80 + 50 |
137.80 $ |
1000 nmol |
LIZ-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
240.00 |
20 x 0.79 = 15.80 |
100.00 |
240 + 15.80 + 100 |
355.80 $ |
100 nmol |
ROX-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.29 = 5.80 |
50.00 |
80 + 5.80 + 50 |
135.80 $ |
200 nmol |
ROX-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.39 = 7.80 |
50.00 |
80 + 7.80 + 50 |
137.80 $ |
1000 nmol |
ROX-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
240.00 |
20 x 0.79 = 15.80 |
100.00 |
240 + 15.80 + 100 |
355.80 $ |
100 nmol |
Cy3 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.29 = 5.80 |
50.00 |
80 + 5.80 + 50 |
135.80 $ |
200 nmol |
Cy3 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.39 = 7.80 |
50.00 |
80 + 7.80 + 50 |
137.80 $ |
1000 nmol |
Cy3 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
240.00 |
20 x 0.79 = 15.80 |
100.00 |
240 + 15.80 + 100 |
355.80 $ |
100 nmol |
Cy5 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.29 = 5.80 |
50.00 |
80 + 5.80 + 50 |
135.80 $ |
200 nmol |
Cy5 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.39 = 7.80 |
50.00 |
80 + 7.80 + 50 |
137.80 $ |
1000 nmol |
Cy5 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
240.00 |
20 x 0.79 = 15.80 |
100.00 |
240 + 15.80 + 100 |
355.80 $ |
100 nmol |
TAMRA dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.29 = 5.80 |
50.00 |
80 + 5.80 + 50 |
135.80 $ |
200 nmol |
TAMRA dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.39 = 7.80 |
50.00 |
80 + 7.80 + 50 |
137.80 $ |
1000 nmol |
TAMRA dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
240.00 |
20 x 0.79 = 15.80 |
100.00 |
240 + 15.80 + 100 |
355.80 $ |
100 nmol |
Texas Red-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.29 = 5.80 |
50.00 |
80 + 5.80 + 50 |
135.80 $ |
200 nmol |
Texas Red-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.39 = 7.80 |
50.00 |
80 + 7.80 + 50 |
137.80 $ |
1000 nmol |
Texas Red-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
240.00 |
20 x 0.79 = 15.80 |
100.00 |
240 + 15.80 + 100 |
355.80 $ |
100 nmol |
D4-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.29 = 5.80 |
50.00 |
80 + 5.80 + 50 |
135.80 $ |
200 nmol |
D4-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
80.00 |
20 x 0.39 = 7.80 |
50.00 |
80 + 7.80 + 50 |
137.80 $ |
1000 nmol |
D4-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
240.00 |
20 x 0.79 = 15.80 |
100.00 |
240 + 15.80 + 100 |
355.80 $ |
100 nmol |
D3-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
210.00 |
20 x 0.29 = 5.80 |
50.00 |
210 + 5.80 + 50 |
265.80 $ |
200 nmol |
D3-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
210.00 |
20 x 0.39 = 7.80 |
50.00 |
210 + 7.80 + 50 |
267.80 $ |
1000 nmol |
D3-replacement dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
340.00 |
20 x 0.79 = 15.80 |
100.00 |
340 + 15.80 + 100 |
455.80 $ |
100 nmol |
Cy5.5 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
210.00 |
20 x 0.29 = 5.80 |
50.00 |
210 + 5.80 + 50 |
265.80 $ |
200 nmol |
Cy5.5 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
210.00 |
20 x 0.39 = 7.80 |
50.00 |
210 + 7.80 + 50 |
267.80 $ |
1000 nmol |
Cy5.5 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
340.00 |
20 x 0.79 = 15.80 |
100.00 |
340 + 15.80 + 100 |
455.80 $ |
100 nmol |
IRD700-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
210.00 |
20 x 0.29 = 5.80 |
50.00 |
210 + 5.80 + 50 |
265.80 $ |
200 nmol |
IRD700-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
210.00 |
20 x 0.39 = 7.80 |
50.00 |
210 + 7.80 + 50 |
267.80 $ |
1000 nmol |
IRD700-repl. dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
340.00 |
20 x 0.79 = 15.80 |
100.00 |
340 + 15.80 + 100 |
455.80 $ |
100 nmol |
Quasar 705 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
210.00 |
20 x 0.29 = 5.80 |
50.00 |
210 + 5.80 + 50 |
265.80 $ |
200 nmol |
Quasar 705 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
210.00 |
20 x 0.39 = 7.80 |
50.00 |
210 + 7.80 + 50 |
267.80 $ |
1000 nmol |
Quasar 705 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-3 |
|
|
|
340.00 |
20 x 0.79 = 15.80 |
100.00 |
340 + 15.80 + 100 |
455.80 $ |
100 nmol |
Cy3.5 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
210.00 |
20 x 0.29 = 5.80 |
50.00 |
210 + 5.80 + 50 |
265.80 $ |
200 nmol |
Cy3.5 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
210.00 |
20 x 0.39 = 7.80 |
50.00 |
210 + 7.80 + 50 |
267.80 $ |
1000 nmol |
Cy3.5 dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
340.00 |
20 x 0.79 = 15.80 |
100.00 |
340 + 15.80 + 100 |
455.80 $ |
100 nmol |
Redmond Red dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
210.00 |
20 x 0.29 = 5.80 |
50.00 |
210 + 5.80 + 50 |
265.80 $ |
200 nmol |
Redmond Red dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
210.00 |
20 x 0.39 = 7.80 |
50.00 |
210 + 7.80 + 50 |
267.80 $ |
1000 nmol |
Redmond Red dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-2 |
|
|
|
340.00 |
20 x 0.79 = 15.80 |
100.00 |
340 + 15.80 + 100 |
455.80 $ |
100 nmol |
Yakima Yellow dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
210.00 |
20 x 0.29 = 5.80 |
50.00 |
210 + 5.80 + 50 |
265.80 $ |
200 nmol |
Yakima Yellow dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
210.00 |
20 x 0.39 = 7.80 |
50.00 |
210 + 7.80 + 50 |
267.80 $ |
1000 nmol |
Yakima Yellow dye |
ACGTACGTACGTACGTACGT (to be replaced with your sequence) |
BHQ-1 |
|
|
|
340.00 |
20 x 0.79 = 15.80 |
100.00 |
340 + 15.80 + 100 |
455.80 $ |
*The above dollar prices are U.S. dollars for customers
outside of Canada; the dollar values are in Canadian dollars only for customers
from Canada, and are subject to government sales taxes (GST, HST, QST).
The taxes are extra (not included in the above prices). The above prices
are for desalted oligos, i.e. without additional purification, which is usually
sufficient for most needs, if the probes are shorter than 30 bases. We
also offer additional purification by OPC or HPLC, which would cost extra (but
is small, compared to the overall price for the probe),
please
inquire by e-mail
to info@alphaadn.com.