Custom DNA (left)Alpha ADN, commandez par fax: 1-800-511-3654Custom DNA (right)

English version here

Sondes pour la PCR en temps réel (PCR quantitative ou qPCR), sondes TaqMan, sondes à double marquage

Pour une description détaillée sur la PCR en temps réel (PCR quantitative ou qPCR), SVP voir le site Wikipédia ici ; pour les sondes TaqMan SVP appuyer ici (toujours à Wikipédia).  Les deux types de sondes sont en effet des sondes à double marquage, dont l'extrémité 5' est modifiée avec un fluorophore, tandis que l'extrémité 3' est modifiée avec un désactivateur (quencher), tel que BHQ, MDQ, ou TAMRA.

Chez Alpha ADN, nous offrons un grand nombre de fluorophores, SVP voir le texte et la table ci-dessous.  Nous offrons également trois types de désactivateurs (quenchers) : (1) TAMRA comme désactivateur pour le FAM. (2) Les Black Hole Quenchers (de la compagnie LGC Biosearch Technologies), notamment le BHQ-1, BHQ-2 et BHQ-3, qui peuvent désactiver la plupart des fluorophores utilisés dans la PCR en temps réel.  (3) MDQ-1 and MDQ-2 (Montreal Dark Quencher-1 et 2) qui peuvent désactiver la plupart des fluorophores utilisés dans la PCR en temps réel (qPCR).

La table ci-dessous n'est pas exhaustive, si vous ne trouvez pas la combinaison de fluorophore et désactivateur dont vous en avez besoin, SVP nous contacter à  Par exemple, si vous voulez reproduire des résultats obtenus avec les désactivateurs MGB (MGBNFQ) ou Iowa Black Quencher, nous pourrions vous suggérer un désactivateur de remplacement, au prix plus bas que le désactivateur original, et la sonde serait couverte par notre garantie de remplacement gratuit.

SVP noter que les prix de certains fluorophores peuvent être moins élevés dans le contexte des sondes à simple marquage (sondes sans désactivateur), comparativement aux prix pour les mêmes fluorophores dans le contexte des sondes à double marquage (sondes avec désactivateur), à cause des réactifs différents utilisés dans la synthès des deux types de sondes.


Liste des prix pour certaines sondes à double marquage, utilisées dans la PCR en temps réel (qPCR) ou sondes TaqMan

Toutes les sondes ci-dessous ont la structure suivante : "Fluorophore 5'-votre_séquence_ADN-3' désactivateur (quencher)".  Pour les fluorophores et/ou les désactivateurs non inclus dans la liste, SVP nous contacter à

Fluorescein---BHQ1, 100 nmol scale

Fluorescein---MDQ1, 100 nmol échelle

Fluorescein---BHQ1, 200 nmol échelle

Fluorescein---MDQ1, 200 nmol échelle

Fluorescein---BHQ1, 1000 nmol échelle

Fluorescein---MDQ1, 1000 nmol échelle

Fluorescein---TAMRA, 100 nmol échelle

Fluorescein---TAMRA, 200 nmol échelle

Fluorescein---TAMRA, 1000 nmol échelle

6-FAM---BHQ1, 100 nmol échelle

6-FAM---MGB, 100 nmol échelle

6-FAM---MDQ1, 100 nmol échelle

6-FAM---BHQ1, 200 nmol échelle

6-FAM---MGB, 200 nmol échelle

6-FAM---MDQ1, 200 nmol échelle

6-FAM---BHQ1, 1000 nmol échelle

6-FAM---MGB, 1000 nmol échelle

6-FAM---MDQ1, 1000 nmol échelle

HEX---BHQ1, 100 nmol échelle

HEX---MDQ1, 100 nmol échelle

HEX---BHQ1, 200 nmol échelle

HEX---MDQ1, 200 nmol échelle

HEX---BHQ1, 1000 nmol échelle

HEX---MDQ1, 1000 nmol échelle

TET---BHQ1, 100 nmol échelle

TET---MDQ1, 100 nmol échelle

TET---BHQ1, 200 nmol échelle

TET---MDQ1, 200 nmol échelle

TET---BHQ1, 1000 nmol échelle

TET---MDQ1, 1000 nmol échelle

6-FAM---TAMRA, 100 nmol scale

6-FAM---TAMRA, 200 nmol scale

6-FAM---TAMRA, 1000 nmol scale

VIC-rempl.---BHQ1, 100 nmol échelle

VIC-rempl.---MDQ1, 100 nmol scale

VIC-rempl.---BHQ1, 200 nmol scale

VIC-rempl.---MDQ1, 200 nmol scale

VIC-rempl.---BHQ1, 1000 nmol scale

VIC-rempl.---MDQ1, 1000 nmol scale

NED-rempl.---BHQ2, 100 nmol échelle
NED-rempl.---MDQ2, 100 nmol échelle
NED-rempl.---BHQ2, 200 nmol échelle
NED-rempl.---MDQ2, 200 nmol échelle
NED-rempl.---BHQ2, 1000 nmol échelle
NED-rempl.---MDQ2, 1000 nmol échelle

PET-rempl.---BHQ2, 100 nmol échelle
PET-rempl.---MDQ2, 100 nmol échelle
PET-rempl.---BHQ2, 200 nmol échelle
PET-rempl.---MDQ2, 200 nmol échelle
PET-rempl.---BHQ2, 1000 nmol échelle
PET-rempl.---MDQ2, 1000 nmol échelle

LIZ-rempl.---BHQ2, 100 nmol échelle
LIZ-rempl.---MDQ2, 100 nmol échelle
LIZ-rempl.---BHQ2, 200 nmol échelle
LIZ-rempl.---MDQ2, 200 nmol échelle
LIZ-rempl.---BHQ2, 1000 nmol échelle
LIZ-rempl.---MDQ2, 1000 nmol échelle

ROX-rempl.---BHQ2, 100 nmol échelle
ROX-rempl.---MDQ2, 100 nmol échelle
ROX-rempl.---BHQ2, 200 nmol échelle
ROX-rempl.---MDQ2, 200 nmol échelle
ROX-rempl.---BHQ2, 1000 nmol échelle
ROX-rempl.---MDQ2, 1000 nmol échelle

Cy3---BHQ2, 100 nmol échelle
Cy3---MDQ2, 100 nmol échelle
Cy3---BHQ2, 200 nmol échelle
Cy3---MDQ2, 200 nmol échelle
Cy3---BHQ2, 1000 nmol échelle
Cy3---MDQ2, 1000 nmol échelle

Cy3.5---BHQ2, 100 nmol échelle
Cy3.5---MDQ2, 100 nmol échelle
Cy3.5---BHQ2, 200 nmol échelle
Cy3.5---MDQ2, 200 nmol échelle
Cy3.5---BHQ2, 1000 nmol échelle
Cy3.5---MDQ2, 1000 nmol échelle

Cy5---BHQ2, 100 nmol échelle
Cy5---MDQ2, 100 nmol échelle
Cy5---BHQ2, 200 nmol échelle
Cy5---MDQ2, 200 nmol échelle
Cy5---BHQ2, 1000 nmol échelle
Cy5---MDQ2, 1000 nmol échelle

Cy5.5---BHQ1, 100 nmol échelle
Cy5.5---MDQ1, 100 nmol échelle
Cy5.5---BHQ1, 200 nmol échelle
Cy5.5---MDQ1, 200 nmol échelle
Cy5.5---BHQ1, 1000 nmol échelle
Cy5.5---MDQ1, 1000 nmol échelle

TAMRA---BHQ2, 100 nmol échelle
TAMRA---MDQ2, 100 nmol échelle
TAMRA---BHQ2, 200 nmol échelle
TAMRA---MDQ2, 200 nmol échelle
TAMRA---BHQ2, 1000 nmol échelle
TAMRA---MDQ2, 1000 nmol échelle

Texas Red-rempl.---BHQ2, 100 nmol échelle
Texas Red-rempl.---MDQ2, 100 nmol échelle
Texas Red-rempl.---BHQ2, 200 nmol échelle
Texas Red-rempl.---MDQ2, 200 nmol échelle
Texas Red-rempl.---BHQ2, 1000 nmol échelle
Texas Red-rempl.---MDQ2, 1000 nmol échelle

D4-rempl.---BHQ2, 100 nmol échelle
D4-rempl.---MDQ2, 100 nmol échelle
D4-rempl.---BHQ2, 200 nmol échelle
D4-rempl.---MDQ2, 200 nmol échelle
D4-rempl.---BHQ2, 1000 nmol échelle
D4-rempl.---MDQ2, 1000 nmol échelle

D3-rempl.---BHQ3, 100 nmol échelle
D3-rempl.---MDQ2, 100 nmol échelle
D3-rempl.---BHQ3, 200 nmol échelle
D3-rempl.---MDQ2, 200 nmol échelle
D3-rempl.---BHQ3, 1000 nmol échelle
D3-rempl.---MDQ2, 1000 nmol échelle

IRD700-rempl.---BHQ3, 100 nmol échelle
IRD700-rempl.---MDQ2, 100 nmol échelle
IRD700-rempl.---BHQ3, 200 nmol échelle
IRD700-rempl.---MDQ2, 200 nmol échelle
IRD700-rempl.---BHQ3, 1000 nmol échelle
IRD700-rempl.---MDQ2, 1000 nmol échelle

Quasar 705---BHQ3, 100 nmol échelle
Quasar 705---MDQ2, 100 nmol échelle
Quasar 705---BHQ3, 200 nmol échelle
Quasar 705---MDQ2, 200 nmol échelle
Quasar 705---BHQ3, 1000 nmol échelle
Quasar 705---MDQ2, 1000 nmol échelle

Redmond Red---BHQ2, 100 nmol échelle
Redmond Red---MDQ2, 100 nmol échelle
Redmond Red---BHQ2, 200 nmol échelle
Redmond Red---MDQ2, 200 nmol échelle
Redmond Red---BHQ2, 1000 nmol échelle
Redmond Red---MDQ2, 1000 nmol échelle

Yakima Yellow---BHQ1, 100 nmol échelle
Yakima Yellow---MDQ1, 100 nmol échelle
Yakima Yellow---BHQ1, 200 nmol échelle
Yakima Yellow---MDQ1, 200 nmol échelle
Yakima Yellow---BHQ1, 1000 nmol échelle
Yakima Yellow---MDQ1, 1000 nmol échelle


Échelle de synthèse fluorophore en 5' Partie ADN de la sonde à double marquage ; la séquence de 20 bases ci-dessous est entrée seulement en titre d'example ; le client doit la remplacer par la séquence de sa propre sonde, et ajouster le prix si nécessaire désactivateur (quencher) en 3' Calcul du prix Prix de la sonde (dessalée), en $ u.s. ou canadiens*
100 nmol fluorescéine ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  24.00 20 x 0.29 = 5.80 50.00 24 + 5.80 + 50 79.80 $
100 nmol fluorescéine ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  24.00 20 x 0.29 = 5.80 39.00 24 + 5.80 + 39 68.80 $
200 nmol fluorescéine ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  24.00 20 x 0.39 = 7.80 50.00 24 + 7.80 + 50 81.80 $
200 nmol fluorescéine ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  24.00 20 x 0.39 = 7.80 39.00 24 + 7.80 + 39 70.80 $
1000 nmol fluorescéine ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  50.00 20 x 0.79 = 15.80 100.00 50 + 15.80 + 100 165.80 $
1000 nmol fluorescéine ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  50.00 20 x 0.79 = 15.80 78.00 50 + 15.80 + 78 143.80 $
100 nmol fluorescéine ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) TAMRA    
  24.00 20 x 0.29 = 5.80 49.00 24 + 5.80 + 49 78.80 $
200 nmol fluorescéine ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) TAMRA    
  24.00 20 x 0.39 = 7.80 49.00 24 + 7.80 + 49 80.80 $
1000 nmol fluorescéine ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) TAMRA    
  50.00 20 x 0.79 = 15.80 149.00 50 + 15.80 + 149 214.80 $
100 nmol 6-FAM ou HEX ou TET ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  29.00 20 x 0.29 = 5.80 50.00 29 + 5.80 + 50 84.80 $
100 nmol 6-FAM ou HEX ou TET ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MGB    
  29.00 20 x 0.29 = 5.80 95.00 29 + 5.80 + 95 129.80 $ (u.s.)
100 nmol 6-FAM ou HEX ou TET ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  29.00 20 x 0.29 = 5.80 39.00 29 + 5.80 + 39 73.80 $
200 nmol 6-FAM ou HEX ou TET ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  29.00 20 x 0.39 = 7.80 50.00 29 + 7.80 + 50 86.80 $
200 nmol 6-FAM ou HEX ou TET ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MGB    
  29.00 20 x 0.39 = 7.80 95.00 29 + 7.80 + 95 131.80 $ (u.s.)
200 nmol 6-FAM ou HEX ou TET ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  29.00 20 x 0.39 = 7.80 39.00 29 + 7.80 + 39 75.80 $
1000 nmol 6-FAM ou HEX ou TET ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  75.00 20 x 0.79 = 15.80 100.00 75 + 15.80 + 100 190.80 $
1000 nmol 6-FAM ou HEX ou TET ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MGB    
  29.00 20 x 0.79 = 15.80 285.00 75 + 15.80 + 285 375.80 $ (u.s.)
1000 nmol 6-FAM ou HEX ou TET ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  75.00 20 x 0.79 = 15.80 78.00 75 + 15.80 + 78 168.80 $
100 nmol 6-FAM ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) TAMRA    
  29.00 20 x 0.29 = 5.80 49.00 29 + 5.80 + 49 83.80 $
200 nmol 6-FAM ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) TAMRA    
  29.00 20 x 0.39 = 7.80 49.00 29 + 7.80 + 49 85.80 $
1000 nmol 6-FAM ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) TAMRA    
  75.00 20 x 0.79 = 15.80 149.00 75 + 15.80 + 149 239.80 $
100 nmol VIC-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  29.00 20 x 0.29 = 5.80 50.00 29 + 5.80 + 50 84.80 $
100 nmol VIC-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  29.00 20 x 0.29 = 5.80 39.00 29 + 5.80 + 39 73.80 $
200 nmol VIC-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  29.00 20 x 0.39 = 7.80 50.00 29 + 7.80 + 50 86.80 $
200 nmol VIC-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  29.00 20 x 0.39 = 7.80 39.00 29 + 7.80 + 39 75.80 $
1000 nmol VIC-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  75.00 20 x 0.79 = 15.80 100.00 75 + 15.80 + 100 190.80 $
1000 nmol VIC-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  75.00 20 x 0.79 = 15.80 78.00 75 + 15.80 + 78 168.80 $
 100 nmol JOE-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  29.00 20 x 0.29 = 5.80 50.00 29 + 5.80 + 50 84.80 $
100 nmol JOE-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  29.00 20 x 0.29 = 5.80 39.00 29 + 5.80 + 39 73.80 $
200 nmol JOE-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  29.00 20 x 0.39 = 7.80 50.00 29 + 7.80 + 50 86.80 $
200 nmol JOE-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  29.00 20 x 0.39 = 7.80 39.00 29 + 7.80 + 39 75.80 $
1000 nmol JOE-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  75.00 20 x 0.79 = 15.80 100.00 75 + 15.80 + 100 190.80 $
1000 nmol JOE-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  75.00 20 x 0.79 = 15.80 78.00 75 + 15.80 + 78 168.80 $
 100 nmol NED-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
100 nmol NED-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.29 = 5.80 39.00 80 + 5.80 + 39 124.80 $
200 nmol NED-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
200 nmol NED-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.39 = 7.80 39.00 80 + 7.80 + 39 126.80 $
1000 nmol NED-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
1000 nmol NED-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  240.00 20 x 0.79 = 15.80 78.00 240 + 15.80 + 78 333.80 $
 100 nmol PET-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
100 nmol PET-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.29 = 5.80 39.00 80 + 5.80 + 39 124.80 $
200 nmol PET-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
200 nmol PET-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.39 = 7.80 39.00 80 + 7.80 + 39 126.80 $
1000 nmol PET-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
1000 nmol PET-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  240.00 20 x 0.79 = 15.80 78.00 240 + 15.80 + 78 333.80 $
 100 nmol LIZ-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
100 nmol LIZ-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.29 = 5.80 39.00 80 + 5.80 + 39 124.80 $
200 nmol LIZ-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
200 nmol LIZ-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.39 = 7.80 39.00 80 + 7.80 + 39 126.80 $
1000 nmol LIZ-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
1000 nmol LIZ-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  240.00 20 x 0.79 = 15.80 78.00 240 + 15.80 + 78 333.80 $
100 nmol ROX-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
100 nmol ROX-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.29 = 5.80 39.00 80 + 5.80 + 39 124.80 $
200 nmol ROX-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
200 nmol ROX-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.39 = 7.80 39.00 80 + 7.80 + 39 126.80 $
 1000 nmol ROX-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
1000 nmol ROX-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  240.00 20 x 0.79 = 15.80 78.00 240 + 15.80 + 78 333.80 $
 100 nmol Cy3 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
100 nmol Cy3 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.29 = 5.80 39.00 80 + 5.80 + 39 124.80 $
200 nmol Cy3 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
200 nmol Cy3 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.39 = 7.80 39.00 80 + 7.80 + 39 126.80 $
1000 nmol Cy3 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
1000 nmol Cy3 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  240.00 20 x 0.79 = 15.80 78.00 240 + 15.80 + 78 333.80 $
 100 nmol Cy5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
100 nmol Cy5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.29 = 5.80 39.00 80 + 5.80 + 39 124.80 $
200 nmol Cy5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
200 nmol Cy5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.39 = 7.80 39.00 80 + 7.80 + 39 126.80 $
1000 nmol Cy5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
1000 nmol Cy5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  240.00 20 x 0.79 = 15.80 78.00 240 + 15.80 + 78 333.80 $
100 nmol TAMRA ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
100 nmol TAMRA ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.29 = 5.80 39.00 80 + 5.80 + 39 124.80 $
200 nmol TAMRA ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
200 nmol TAMRA ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.39 = 7.80 39.00 80 + 7.80 + 39 126.80 $
1000 nmol TAMRA ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
1000 nmol TAMRA ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  240.00 20 x 0.79 = 15.80 78.00 240 + 15.80 + 78 333.80 $
 100 nmol Texas Red-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
 100 nmol Texas Red-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.29 = 5.80 39.00 80 + 5.80 + 39 124.80 $
 200 nmol Texas Red-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
200 nmol Texas Red-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.39 = 7.80 39.00 80 + 7.80 + 39 126.80 $
1000 nmol Texas Red-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
1000 nmol Texas Red-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  240.00 20 x 0.79 = 15.80 78.00 240 + 15.80 + 78 333.80 $
 100 nmol D4-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
100 nmol D4-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.29 = 5.80 39.00 80 + 5.80 + 39 124.80 $
200 nmol D4-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
200 nmol D4-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  80.00 20 x 0.39 = 7.80 39.00 80 + 7.80 + 39 126.80 $
1000 nmol D4-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
 1000 nmol D4-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  240.00 20 x 0.79 = 15.80 78.00 240 + 15.80 + 78 333.80 $
 100 nmol D3-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
100 nmol D3-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.29 = 5.80 39.00 210 + 5.80 + 39 254.80 $
200 nmol D3-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
200 nmol D3-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.39 = 7.80 39.00 210 + 7.80 + 39 256.80 $
 1000 nmol D3-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
1000 nmol D3-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  340.00 20 x 0.79 = 15.80 78.00 340 + 15.80 + 78 433.80 $
 100 nmol Cy5.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
100 nmol Cy5.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.29 = 5.80 39.00 210 + 5.80 + 39 254.80 $
200 nmol Cy5.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
200 nmol Cy5.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.39 = 7.80 39.00 210 + 7.80 + 39 256.80 $
1000 nmol Cy5.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
1000 nmol Cy5.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  340.00 20 x 0.79 = 15.80 78.00 340 + 15.80 + 78 433.80 $
 100 nmol IRD700-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
100 nmol IRD700-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.29 = 5.80 39.00 210 + 5.80 + 39 254.80 $
200 nmol IRD700-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
200 nmol IRD700-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.39 = 7.80 39.00 210 + 7.80 + 39 256.80 $
1000 nmol IRD700-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
1000 nmol IRD700-rempl. ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  340.00 20 x 0.79 = 15.80 78.00 340 + 15.80 + 78 433.80 $
100 nmol Quasar 705 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
100 nmol Quasar 705 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.29 = 5.80 39.00 210 + 5.80 + 39 254.80 $
200 nmol Quasar 705 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
200 nmol Quasar 705 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.39 = 7.80 39.00 210 + 7.80 + 39 256.80 $
1000 nmol Quasar 705 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-3    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
1000 nmol Quasar 705 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  340.00 20 x 0.79 = 15.80 78.00 340 + 15.80 + 78 433.80 $
100 nmol Cy3.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
100 nmol Cy3.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.29 = 5.80 39.00 210 + 5.80 + 39 254.80 $
200 nmol Cy3.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
200 nmol Cy3.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.39 = 7.80 39.00 210 + 7.80 + 39 256.80 $
1000 nmol Cy3.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
1000 nmol Cy3.5 ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  340.00 20 x 0.79 = 15.80 78.00 340 + 15.80 + 78 433.80 $
 100 nmol Redmond Red ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
100 nmol Redmond Red ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.29 = 5.80 39.00 210 + 5.80 + 39 254.80 $
200 nmol Redmond Red ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
200 nmol Redmond Red ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  210.00 20 x 0.39 = 7.80 39.00 210 + 7.80 + 39 256.80 $
1000 nmol Redmond Red ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-2    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
1000 nmol Redmond Red ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-2    
  340.00 20 x 0.79 = 15.80 78.00 340 + 15.80 + 78 433.80 $
 100 nmol Yakima Yellow ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
100 nmol Yakima Yellow ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  210.00 20 x 0.29 = 5.80 39.00 210 + 5.80 + 39 254.80 $
200 nmol Yakima Yellow ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
200 nmol Yakima Yellow ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  210.00 20 x 0.39 = 7.80 39.00 210 + 7.80 + 39 256.80 $
1000 nmol Yakima Yellow ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) BHQ-1    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
1000 nmol Yakima Yellow ACGTACGTACGTACGTACGT (à remplacer avec votre séquence) MDQ-1    
  340.00 20 x 0.79 = 15.80 78.00 340 + 15.80 + 78 433.80 $

*Les prix ci-dessus sont en dollars u.s. pour nos clients dehors le Canada.  Les mêmes prix sont en dollars canadiens seulement pour nos clients du Canada et ils sont assujettis aux taxes sur les ventes (TPS, TVH, TVQ).  Les taxes ne sont pas incluses dans les prix affichés ci-dessus et ailleurs sur notre site Web.  Les prix ci-dessus sont pour sondes dessalées, i.e. sans purification supplémentaire ; ceci est d'habitude suffisant pour la plupart des besoins expérimentaux, en particulier si les amorces sont plus courtes que 30 bases.  Nous offrons également des purifications par OPC ou HPLC pour toutes les sondes à double marquage ; le coût de la purification supplémentaire dépend du type de purification et de l'échelle de synthèse, mais de toute façon, ce prix est relativement petit comparativement au prix total de la sonde.  Pour plus de précisions et le prix exact, SVP nous écrire au

Contactez-nousPage d'AccueilProduits et PrixInformations utiles

© 1997-2019 Alpha ADN