Custom DNA (left)Alpha ADN, toll-free fax for orders 1-800-511-3654Custom DNA (right)


Version française ici
NEW:  COVID-19 primers and probes used in different counties worldwide, according to the WHO (the World Health Organization)
Primer/probe name DNA sequence (5' to 3') recommended primer/probe final concentration (nM = nmol/liter) Alpha DNA (Alpha ADN) synthetic DNA primers and probes
catalog number synthesis scale guaranteed minimum DNA quantity (desalted oligonucleotides) Number of reactions per delivered product, 25 µl PCR reaction volume) Price in USD
Primers and probes allowed by the CDC (Atlanta, Georgia) for use in the USA:
2019-nCoV_Nl-F  GACCCCAAAATCAGCGAAAT 500 nM U1 200 nmol 50 nmol /10 OD >4000 7.80
2019-nCoV_Nl-R  TCTGGTTACTGCCAGTTGAATCTG 500 nM U2 200 nmol 50 nmol /10 OD >4000 9.36
2019-nCoV_Nl-P  FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 125 nM U3 200 nmol 50 nmol /10 OD >16000 88.36
2019-nCoV_N2-F  TTACAAACATTGGCCGCAAA 500 nM U4 200 nmol 50 nmol /10 OD >4000 7.80
2019-nCoV_N2-R  GCGCGACATTCCGAAGAA 500 nM U5 200 nmol 50 nmol /10 OD >4000 7.02
2019-nCoV_N2-P  FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1 125 nM U6 200 nmol 50 nmol /10 OD >16000 87.97
2019-nCoV_N3-F  GGGAGCCTTGAATACACCAAAA 500 nM U7 200 nmol 50 nmol /10 OD >4000 8.58
2019-nCoV_N3-R  TGTAGCACGATTGCAGCATTG 500 nM U8 200 nmol 50 nmol /10 OD >4000 8.19
2019-nCoV_N3-P  FAM-AYCACATTGGCACCCGCAATCCTG-BHQ1 125 nM U9 200 nmol 50 nmol /10 OD >16000 88.36
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG 500 nM U10 200 nmol 50 nmol /10 OD >4000 7.41
RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT 500 nM U11 200 nmol 50 nmol /10 OD >4000 7.80
RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1 125 nM U12 200 nmol 50 nmol /10 OD >16000 87.97
 
Primers and probes used in mainland China (新型冠状病毒核酸检测引物和探针序列) :
Target 1ORF1ab:              
正向引物 ORF1ab(F): CCCTGTGGGTTTTACACTTAA 500 nM C1 200 nmol 50 nmol /10 OD >4000 8.19
反向引物 ORF1ab(R): ACGATTGTGCATCAGCTGA 500 nM C2 200 nmol 50 nmol /10 OD >4000 7.41
荧光探针 ORF1ab(P): FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1 150 nM C3 200 nmol 50 nmol /10 OD >13333 89.92
Target 2N:              
正向引物 N(F): GGGGAACTTCTCCTGCTAGAAT 500 nM C4 200 nmol 50 nmol /10 OD >4000 8.58
反向引物 N(R): CAGACATTTTGCTCTCAAGCTG 500 nM C5 200 nmol 50 nmol /10 OD >4000 8.58
荧光探针 N(P): FAM-TTGCTGCTGCTTGACAGATT-BHQ1 150 nM C6 200 nmol 50 nmol /10 OD >13333 86.8
 
Primers and probes used in the Hong Kong Special Administrative Region of China:
Assay 1 (Target: ORF1b-nsp14)
HKU-ORF1b-nsp14F TGGGGYTTTACRGGTAACCT 500 nM H1 200 nmol 50 nmol /10 OD >4000 7.80
HKU- ORF1b-nsp14R AACRCGCTTAACAAAGCACTC 500 nM H2 200 nmol 50 nmol /10 OD >4000 8.19
(HKU-ORF1b-nsp141P FAM-TAGTTGTGATGCWATCATGACTAG-BHQ1 250 nM H3 200 nmol 50 nmol /10 OD >8000 88.36
Assay 2 (Target: N)              
HKU-NF TAATCAGACAAGGAACTGATTA 500 nM H4 200 nmol 50 nmol /10 OD >4000 8.58
HKU-NR CGAAGGTGTGACTTCCATG 500 nM H5 200 nmol 50 nmol /10 OD >4000 7.41
HKU-NP FAM-GCAAATTGTGCAATTTGCGG-BHQ1 250 nM H6 200 nmol 50 nmol /10 OD >8000 86.80
               
Primers and probes used in Japan:
1)      ORF1a set (regular PCR, not real-time PCR)
NIID_WH-1_F501 (S) TTCGGATGCTCGAACTGCACC 500 nM J1 200 nmol 50 nmol /10 OD >4000 8.19
NIID_WH-1_R913 (AS)  CTTTACCAGCACGTGCTAGAAGG 500 nM J2 200 nmol 50 nmol /10 OD >4000 8.97
NIID_WH-1_F509 (S)  CTCGAACTGCACCTCATGG 500 nM J3 200 nmol 50 nmol /10 OD >4000 7.41
NIID_WH-1_R854 (AS)  CAGAAGTTGTTATCGACATAGC 500 nM J4 200 nmol 50 nmol /10 OD >4000 8.58
NIID_WH-1_Seq_F519 (S)  ACCTCATGGTCATGTTATGG 500 nM J5 200 nmol 50 nmol /10 OD >4000 7.80
NIID_WH-1_Seq_R840 (AS)  GACATAGCGAGTGTATGCC 500 nM J6 200 nmol 50 nmol /10 OD >4000 7.41
2)      S set (regular PCR, not real-time PCR)
WuhanCoV-spk1-f (S)  TTGGCAAAATTCAAGACTCACTTT 500 nM J7 200 nmol 50 nmol /10 OD >4000 9.36
WuhanCoV-spk2-r (AS)  TGTGGTTCATAAAAATTCCTTTGTG 500 nM J8 200 nmol 50 nmol /10 OD >4000 9.75
NIID_WH-1_F24381 (S)  TCAAGACTCACTTTCTTCCAC 500 nM J9 200 nmol 50 nmol /10 OD >4000 8.19
NIID_WH-1_R24873 (AS)  ATTTGAAACAAAGACACCTTCAC 500 nM J10 200 nmol 50 nmol /10 OD >4000 8.97
NIID_WH-1_Seq_F24383 (S)  AAGACTCACTTTCTTCCACAG 500 nM J11 200 nmol 50 nmol /10 OD >4000 8.19
NIID_WH-1_Seq_R24865 (AS)  CAAAGACACCTTCACGAGG 500 nM J12 200 nmol 50 nmol /10 OD >4000 7.41
3)      Primers and probes for real-time RT-PCR
NIID_2019-nCOV_N_F2  AAATTTTGGGGACCAGGAAC 500 nM J13 200 nmol 50 nmol /10 OD >4000 7.80
NIID_2019-nCOV_N_R2  TGGCAGCTGTGTAGGTCAAC 700 nM J14 200 nmol 50 nmol /10 OD >2857 7.80
NIID_2019-nCOV_N_P2  FAM-ATGTCGCGCATTGGCATGGA-BHQ 200 nM J15 200 nmol 50 nmol /10 OD >10000 86.41
 
Primers and probes used in Germany:
Assay 1 (RdRRP)
RdRP_SARSr-F2  GTGARATGGTCATGTGTGGCGG 600 nM G1 200 nmol 50 nmol /10 OD >3333 8.58
RdRP_SARSr-R1  CARATGTTAAASACACTATTAGCATA 800 nM G2 200 nmol 50 nmol /10 OD >2500 10.14
RdRP_SARSr-P2  FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1 100 nM G3 200 nmol 50 nmol /10 OD >20000 88.75
(the above probe is specific for 2019-nCoV, will not detect SARS-CoV)
RdRP_SARSr-P1  FAM-CCAGGTGGWACRTCATCMGGTGATGC-BHQ1 100 nM G4 200 nmol 50 nmol /10 OD >20000 89.14
(the above probe is a Pan-Sarbeco probe, will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs)
Assay 2 (E gene) (this set is identical to the one used in France, as is the final concentration of the primers and probes)
E_Sarbeco_F1  ACAGGTACGTTAATAGTTAATAGCGT 400 nM G5 200 nmol 50 nmol /10 OD >5000 10.14
E_Sarbeco_R2  ATATTGCAGCAGTACGCACACA 400 nM G6 200 nmol 50 nmol /10 OD >5000 8.58
E_Sarbeco_P1  FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 200 nM G7 200 nmol 50 nmol /10 OD >10000 89.14
Assay 3 (N gene), see https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6988269/
N_Sarbeco_F CACATTGGCACCCGCAATC 600 nM G8 200 nmol 50 nmol /10 OD >3333 7.41
N_Sarbeco_R GAGGAACGAGAAGAGGCTTG 800 nM G9 200 nmol 50 nmol /10 OD >2500 7.80
N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BHQ1 200 nM G10 200 nmol 50 nmol /10 OD >10000 88.75
 
Primers and probes used in Thailand:
WH-NIC N-F  CGTTTGGTGGACCCTCAGAT 1000 nM T1 200 nmol 50 nmol /10 OD >2000 7.80
(the above primer partially overlaps with the CDC probe 2019-nCoV_Nl-P)            
WH-NIC N-R  CCCCACTGCGTTCTCCATT 1000 nM T2 200 nmol 50 nmol /10 OD >2000 7.41
WH-NIC N-P  FAM-CAACTGGCAGTAACCA-BQH1 250 nM T3 200 nmol 50 nmol /10 OD >8000 85.24
 
Primers and probes used in France (Insitut Pasteur, Paris):
RdRp gene / nCoV_IP2
nCoV_IP2-12669Fw  ATGAGCTTAGTCCTGTTG 400 nM F1 200 nmol 50 nmol /10 OD >5000 7.02
nCoV_IP2-12759Rv  CTCCCTTTGTTGTGTTGT 400nM F2 200 nmol 50 nmol /10 OD >5000 7.02
nCoV_IP2-12696bProbe HEX-AGATGTCTTGTGCTGCCGGTA-BHQ1 160 nM F3 200 nmol 50 nmol /10 OD >12500 87.19
RdRp gene / nCoV_IP4
nCoV_IP4-14059Fw  GGTAACTGGTATGATTTCG 400 nM F4 200 nmol 50 nmol /10 OD >5000 7.41
nCoV_IP4-14146Rv  CTGGTCAAGGTTAATATAGG 400 nM F5 200 nmol 50 nmol /10 OD >5000 7.80
nCoV_IP4-14084Probe(+)  FAM-TCATACAAACCACGCCAGG-BHQ1 160 nM F6 200 nmol 50 nmol /10 OD >12500 86.41
E gene/E_Sarbeco (this set is identical to the one used in Germany, as is the final concentration of the primers and probes)
E_Sarbeco_F1  ACAGGTACGTTAATAGTTAATAGCGT 400 nM F7 200 nmol 50 nmol /10 OD >5000 10.14
E_Sarbeco_R2  ATATTGCAGCAGTACGCACACA 400 nM F8 200 nmol 50 nmol /10 OD >5000 8.58
E_Sarbeco_P1  FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 200 nM F9 200 nmol 50 nmol /10 OD >10000 89.14

 

Custom DNA Oligonucleotide Synthesis

Current Oligonucleotide Prices (desalted oligos, free desalting included):

Synthesis scale

Oligo length

Guaranteed

minimum yield*

Price per base

(USD)

Price per base

(CAD)**

Extra cost

(USD/CAD)

25 nmole

10-65 bases

 2 OD or 5 nmole

0.18

0.18

0.00

100 nmole

Any (oligos shorter than 10

bases are charged as 10-mers)

6 OD or 25 nmole

0.29

0.29

0.00

200 nmole

Any (oligos shorter than 10

bases are charged as 10-mers)

12 OD or 50 nmole

0.39

0.39

0.00

1000 nmole

(1 µmole)

Any (oligos shorter than 10

bases are charged as 10-mers)

50 OD or 500 nmole

0.79

0.79

0.00

15000 nmole

(15 µmole)

Any

600 OD or 5000 nmole

(3500 nmole for oligos < 5 bases)

6.50

6.50

30.00 per oligo

*The relations between different units for oligo quantification are calculated by a computer, but as an approximation for a 20-base long oligo, 50 nmole equals approx. 10 OD units (at 260 nm wavelength) or 300 micrograms.  Example: An 8-mer oligo CTACTAGC is ordered at the 100 nmole scale; the final DNA quantity delivered to the customer is 71 nmole (71000 pmole), which for this particular oligo equals 168 micrograms and 5.3 OD units.  Our guaranteed minimum is either 6 OD or 25 nmole.  The delivered product does not have 6 OD (it is only 5.3 OD units), but at 71 nmole, it is almost three times more than the guaranteed 25 nmole; therefore, the actual yield is considered sufficient (higher than the guaranteed minimum).  The above table is for desalted oligos without additional purifications or modifications. The guaranteed minimum for oligos with additional purification is usually 40% of the guaranteed minimum for desalted oligos.  Oligos with additional modifications may yield less than the guaranteed minimum for oligos without

modifications.

**The prices in Canadian dollars are valid only for customers from Canada, and are subject to government sales taxes (GST, HST, QST).  The taxes are extra (not included in the above prices).

Fluorescent oligos:  Most of our fluorescent dyes are now only 29 USD / 29 CAD per modification, either 5' or 3' label, 100 nmole or 200 nmole scale:  FAM, HEX, TET, VIC-replacement, NED-replacement, PET-replacement, Texas Red, JOE, Cy3, Cy3.5, Cy5, Cy5.5, and many more, click here for details on the single-label probes.  For dual-label probes (real-time PCR probes, qPCR probes, TaqMan probes) please click here.  Our prices for the dual-label probes are among the lowest in the world, starting from less than 70 dollars per probe. 

Add your country or U.S. state to the list of our customers, and get 25% off your first order(s)!  Click here for details.

 

More than 99% of all orders are shipped within 24 hours (excluding weekends and holidays).

To Alpha ADN address, fax and E-mail contact infoTo Alpha ADN Products and PricesTo Alpha ADN Useful Info


© 1997-2020  Alpha ADN